Nate’s Plates 96-well 105 Plate Kit

$5,000.00

Normalization and Tagging Kit for 10,080 samples in 96-well PCR plates.

View Nate’s Plates Protocol

Out of stock

SKU: 1105 Category:

Description

PLEASE NOTE: When ordering this item, please select FedEx Overnight as the shipping. This is required due to the temperature-sensitive nature of some components. All orders received with the incorrect shipping item will be canceled.

Nate’s Plates is a PCR-based normalization kit designed to incorporate dual indexing tags and return equal numbers of sequencing constructs from each sample.

This kit replaces PCR2 in the standard GT-seq library preparation protocol and eliminates the need for expensive plate-based amplicon capture/normalization.

This process saves time by combining tagging and normalization into a single step and saves money by omitting pipetting steps coupled with 5μL reaction volumes.

Nate’s Plates are designed to work with the following Illumina tag sequences:

  • R1: CTACACGTTCAGAGTTCTACAGTCCGACGATC  OR  CGACTCGTTCAGAGTTCTACAGTCCGACGATC
  • R2: GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT

This Kit includes:

  • 105 unique 96-well tagging plates
  • Magnetic Beads
  • Wash Buffer
  • Bead Release Primer
  • Bead Buffer

User-Supplied Reagents Not Included:

  • PCR Master Mix (we recommend QIAGEN Multiplex PCR Kit)
  • Magnetic Stand/Rack
  • Nuclease-free H₂O
  • Optional Centrifuge Pooling Trays (GTseek SKU #2001)

Patent Pending.

Additional information

Weight 7 lbs
Dimensions 18 × 12 × 6 in

You may also like…