Nate’s Plates 96-well 10 Plate Kit

$600.00

PCR Normalization and Tagging Kit for 960 samples in 96-well PCR plates.

5 in stock

SKU: 1010 Category:

Description

Nate’s Plates is a PCR-based normalization kit designed to incorporate dual indexing tags and return equal numbers of sequencing constructs from each sample. This kit replaces PCR2 in the standard GT-seq library preparation protocol and eliminates the need for expensive plate-based amplicon capture/normalization. This process saves time by combining tagging and normalization into a single step and saves money by omitting pipetting steps coupled with 5μL reaction volumes. Nate’s Plates are designed to work with the following Illumina tag sequences:
  • R1: CTACACGTTCAGAGTTCTACAGTCCGACGATC  OR  CGACTCGTTCAGAGTTCTACAGTCCGACGATC
  • R2: GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
This Kit includes:
  • 10 unique 96-well tagging plates
  • Magnetic Beads
  • Wash Buffer
  • Bead Release Primer
  • Bead Buffer
User-Supplied Reagents Not Included:
  • PCR Master Mix (we recommend QIAGEN Multiplex PCR Kit)
  • Magnetic Stand/Rack
  • Nuclease-free H₂O
  • Optional Centrifuge Pooling Trays (GTseek SKU #2001)
Patent Pending.

Additional information

Weight 4 lbs
Dimensions 10 × 6 × 6 in

Reviews

There are no reviews yet.

Be the first to review “Nate’s Plates 96-well 10 Plate Kit”

Your email address will not be published. Required fields are marked *

You may also like…