Nate’s Plates 96-well 10 Plate Kit

PLEASE NOTE: When ordering this item, please select FedEx Overnight as the shipping. This is required due to the temperature-sensitive nature of some components. All orders received with the incorrect shipping item will be canceled.

Nate’s Plates is a PCR-based normalization kit designed to incorporate dual indexing tags and return equal numbers of sequencing constructs from each sample.

This kit replaces PCR2 in the standard GT-seq library preparation protocol and eliminates the need for expensive plate-based amplicon capture/normalization.

This process saves time by combining tagging and normalization into a single step and saves money by omitting pipetting steps coupled with 5μL reaction volumes.

Nate’s Plates are designed to work with the following Illumina tag sequences:

• R1: CTACACGTTCAGAGTTCTACAGTCCGACGATC  OR  CGACTCGTTCAGAGTTCTACAGTCCGACGATC
• R2: GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT

This Kit includes:

• 10 unique 96-well tagging plates
• Magnetic Beads
• Wash Buffer
• Bead Release Primer
• Bead Buffer

User-Supplied Reagents Not Included:

• PCR Master Mix (we recommend QIAGEN Multiplex PCR Kit)
• Magnetic Stand/Rack
• Nuclease-free H₂O
• Optional Centrifuge Pooling Trays (GTseek SKU #2001)

Patent Pending.